Werebears and Only Children

Movin' on Up

2008-09-09T22:57:00.004-02:30

Werebears and Only Children has officially been re-located to:

It's my fancy new website that is more customizable, thanks to ComicPress. Which I still need to learn more about.

I'm going to leave this blog up for now, as a temporary archive.

Please continue reading my comic and checking out my artwork from time to time.

And you can still find new comics that are different from the ones seen online, every two weeks in the free print edition of The Scope.

Thanks so much for stopping by!

Piss and butts and bombs, oh my!

2008-09-06T13:35:00.000-02:30

In honour of the new show up at A1C Gallery in St. John's.
Be sure to check 'er out if you're in town.

Oceans of ghosts

2008-09-04T00:17:00.001-02:30

Based on an actual conversation.
Of course, the first thing to consider is whether the ghosts even exist at all...

Scrub-a-dub-dub

2008-09-01T12:27:00.000-02:30

So, so, mean, yet so funny. Although it’s a horrible experience. Sometimes the water goes really cold, and sometimes it goes really hot. I don’t know why. But I hear plumbers make good money, so maybe I’ll look into it myself.

The hunt for futility

2008-08-24T17:08:00.002-02:30

Why is it called a scavenger hunt? Isn’t that weird? I thought Wikipedia could help me, but it can’t! I am taken aback.

Dolphins - the cute fish

2008-08-20T11:26:00.002-02:30

I don't think riding a dolphin would be as fun as it sounds, especially if you can't swim very well or tend to slip off of slippery things. I wonder what the Latin word for dolphin is...

24 HAM 08

2008-08-16T13:38:00.002-02:30

Maybe I'll see you there!

www.easternedge.ca
http://www.24hourartmarathon.blogspot.com/

Unicorn, Twonicorn

2008-08-13T23:04:00.001-02:30

Some chap was really messing with us when he named this magical creature!
What a ham, indeed.

Everybody get in my pants

2008-08-11T00:04:00.002-02:30

I've never really had anyone to share clothes with, and I am thankful for that.

Blame yer glasses, not the peepers

2008-08-07T00:11:00.002-02:30

I heard this and then looked up glass on Wikipedia. It seems to be a myth, but that’s according to Wikipedia, so I’m still not sure what’s going on with the state of the beloved substance.

In other news, my new website is up and running. I'll be posting comics and arty news and pics. Here it is: www.jbarrettart.com

I'll keep this blog going for a little while longer, and then it will become the Werebears "archives". Okay!

Making it work

2008-07-22T23:49:00.003-02:30

Well, there's been a bit of a lull here, but for a good reason. I'm going to the San Diego Comic Con tomorrow and I've been working on my first mini comic! 29 pages of brand-spankin'-new comics! Hopefully I can get some trades on.

And here's a preview of the first two pages! Just for you. And thank you so much for stopping by to have a peek.

Uri Uri, oh-oh, you gotta go

2008-07-09T23:44:00.003-02:30

Here’s a LINK to an awesome video of James Randi , renowned magician and skeptic, exposing two of the greatest scam artists I’ve never heard of. Have a gander!

Your pants may be on fire

2008-06-24T11:32:00.000-02:30

Sometimes you just have to pretend you’re doing something that you’re not really doing. Maybe you want to be left alone. Maybe you want to look smart. Maybe you want to look stupid. The moral is, we all tell lies.
I’m sure Aesop covered that one at some point.

Au Natural

2008-06-16T11:36:00.002-02:30

I'm not actually against camping, although I generally like to take it one night at a time.
My favorite part is the campfire, of course. And cooking breakfast! And packing everything up to leave is usually the pain in the arse of the trip. My tip: don't forget to pack some type of light source. It gets pretty dark out there!

Paintzzzzzzzzz

2008-06-09T16:38:00.002-02:30

Suddenly, I feel like painting a toaster. I mean, a painting of a toaster, not just painting a coat on an existing toaster.
Here's the website of one of my old professors; he likes to sculpt very fancy toasters.

Twinkle, twinkle, you know the rest

2008-06-05T10:59:00.002-02:30

Apparantly, there have been several close-calls over the past couple of years of meteors almost hitting the earth. Big ones that can do a lot of damage. And basically, there's no real system set in place to watch out for this stuff.
I say apparantly, because this is second-hand information, and I can't back it up with a link or anything.
Somewhat related is this awesome podcast (thanks Paul): The Skeptic's Guide to the Universe

C * Centennial Post * C

2008-05-30T22:09:00.002-02:30

It's true, the Brazilian government has released photos of an "uncontacted" tribe near the Peru border. They say they're showing these pictures to prove the existance of the tribe and to protect them from the illegal logging industry, which is apparantly pretty huge. They say there are probably about 100 tribes like this left in the world. Link to video.

This reminds me of a similar tribe I read about in an old high school textbook, the Tasaday. I thought this was so fascinating that I Googled it, only to find out that the entire thing was an elaborate hoax! Crazy!!

Finger lickin' good

2008-05-28T19:51:00.002-02:30

Yes sir, I went to my very first lobster boil on the weekend (thanks K and C).
I've had lobster before, but never a whole one to myself!
I had a shell of a time trying to eat the bugger, but it sure was a gas.

Fact: you burn more calories eating a lobster than a lobster has calories. But not if you eat it from a can.

Your eyes may need some time to readjust

2008-05-22T11:58:00.003-02:30

I'm trying out this different horizontal format today. I'm eventually going to be uploading my comics on a new website using ComicPress, and this arrangement is more web-friendly. Meaning, you won't have to click on it to enlarge it and scroll up or down to read the whole thing. Although I've reduced it to six panels, and I'm not sure how I feel about that yet. It seems lazy, for some reason...

I've never really used WordPress much before. If anybody has used the ComicPress theme and is willing to let me e-mail them some questions, please let me know!

A typical day at work

2008-05-16T17:39:00.004-02:30

Some of the statements in this comic may or may not be true.
This conversation may or may not have taken place.

A fine beating, indeed

2008-05-11T22:39:00.001-02:30

You have to set a troll on fire or burn it with acid to completely destroy it! How 'bout that?
This is good information to have, no?
For a more thorough history of Spartopia, go here.

Not monkeys, but monkey-like creatures

2008-05-08T19:25:00.003-02:30

In case you haven't already had your childhood fix of cartoons since discovering youtube.com, feel free to check this out: LINK
And THIS is one of the funniest things I've ever seen :D

It's so gouda

2008-05-02T17:57:00.003-02:30

I seem to be using a lot of orange lately; I don't know what is up with that.
Could this be any more orange? And is that a huge mousetrap or what? All common sense is out the window today.
Heheh.
I was going for a real Cheese Whiz hue there, what do you think?

Roll up your change - you might be surprised!

2008-04-24T00:16:00.002-02:30

Yep, rolled up my change the other day and had almost $200! Almost a Wii ! I just have to find one.

How do you tuna fish?

2008-04-15T00:13:00.001-02:30

For the life of me I can't figure out what that little round thing you blow into before a song is called! Does anybody??

I hate the Family Circus

2008-04-08T22:27:00.002-02:30

Look at what a terrible house-designer I would be! I mean architect!
But man, I just saw some awesome wallpaper here (linked from BoingBoing). Checkerout.

That didn't quite work out the way I expected

2008-04-06T11:26:00.003-02:30

A A
AA AA

CATCATCATCA

CATCATCATCATC

CATCATCATCATCA

TCATCATCATCAT

CATCATCATCATC

ATCATCATCAT

CATCATCATCATCA

CATCATCATCATCATCA

CATCATCATCATCATCAT

CATCATCATCATCATCATC A

ATCATCATCATCATCATCAT CA

CATCATCATCATCATCATCA TCA

TCATCATCATCATCATCAT CAT

CATCATCATCATCATCATCA TCA

TCATCATCATCATCATCATCATCATCAT

CATCATCATCATCATCAT CAT CATC

Take a good look at yourself

2008-03-31T21:43:00.002-02:30

Always with the insults, this one.
I've had instructors that have drawn on my drawings and painted on my paintings. It's a little insulting. I guess for that instant they think they know better than you and can save your picture if you'd just let them have a go at it. But who are they kidding? That thing was hopeless from the start when you made the eyes look like fried eggs and the clouds look like heavy blobs.

Probably a good way to hurt yourself

2008-03-26T23:40:00.002-02:30

This arose after a conversation about the ball pit in a certain children's restaurant. I was at one years ago and the play area was "Closed for yearly cleaning".

Why did Jesus hire a bunny when a kangaroo makes more sense?

2008-03-23T14:30:00.003-02:30

All in a day's work

2008-03-21T15:11:00.003-02:30

Savin' cats don't pay the bills. Unless you're a fireman. A real one, not volunteer.

Top O' The Evenin' to Ya

2008-03-17T20:21:00.002-02:30

Happy St. Patrick's Day to you.
Even if you're all snowed in, I hope you're able to relax and get cozy.
And here's your regularly scheduled (sort of) comic:
It's about making dolls and stuff out of paper (origami excluded!).
And here's something I did for a recent Eastern Edge Gallery fundraiser. It's meant to adorn a beer bottle:

Julie Andrews was made of paper

2008-03-15T15:53:00.003-02:30

Umbrellas are very cool and fashionable accessories, but totally unpractically in this windswept land.
Other famous umbrella-wielders:
The Penguin
Hagrid
The girl with that crappy song
Girl in the Monet painting
Lady in the Japanese print
Gene Kelly
And in my new favorite comic, The Umbrella Academy, they wear one on their costumes.

edit: Had to make it more clear that he was pulling a lamp out of the bag, because Somebody thought it kinda looked like the umbrella going into it. Fair enough.

Only six more months of winter

2008-03-13T23:44:00.002-02:30

I DID have a snow day today and I DID do some housework! Well, I watered the plants and washed the dishtowels, but that's something. I also had time to work on a couple of applications today, which is awesome. I was so into it, that it was suddenly 3:00 in the afternoon, while I felt it was only about 1:00. Which makes me wonder if I went through some sort of worm hole, or did the storm cause some kinda glitch in the space-time continuum? Must consult Dr. Hawking.

Because the earth isn't big enough anymore

2008-03-11T23:50:00.001-02:30

You Lose ... one hour of sleep

2008-03-08T20:14:00.003-03:30

I do like the fact that it won't get dark until later in the evening when DST starts. Especially living in the season-less kingdom that is Newfoundland.
But enough about the weather! How 'bout them Unicorns? What, we don't have a team named after unicorns? Shouldn't we have one of those by now?

I saw a frog once, under a trike at the cabin

2008-03-04T22:30:00.003-03:30

Sad news today, Gary Gygex, co-creater of Dungeons and Dragons has died. Or, failed his savings throw, as my friend puts it.
You can see my old D&D comic here, previously posted at the TADA blog.

I always had to ruin a perfectly good pair of socks to make a sock puppet.

2008-03-02T23:59:00.002-03:30

I suppose this is my take on good ol' Punch and Judy. Which I suppose should really be called Punch and Punchbag. But what do I know about classic theatre?

In other puppet news, they're working on a sequal to The Dark Crystal. To find out who "they" are, follow the link!

Tonight we dine in the rec room

2008-02-24T11:27:00.003-03:30

I'm gonna say this one is movie - themed, in honour of tonight's Oscars ceremony. Go Juno!

Go Madame Tutli-Putli! Go I Met the Walrus! Go Persepolis! Three animated films that I will likely never see :/ But we'll root for them anyhow.

Comin' Atcha! In THREE Dimensions!

2008-02-23T22:27:00.004-03:30

Check it out! My Valentine's Day surprise from the super-duper boyfriend! Modelled after a lino-cut from last year! In Super Sculpy, no less! Just look at those shadows. Fantastic.

One Marshmallow, Two Marshmallow, Three Marshmallow, Four

2008-02-15T23:55:00.002-03:30

Here are some awesome World Record and Marshmallow links for you to explore!

World Record

Marshie

Happy V Day

2008-02-14T08:01:00.001-03:30

Mr. Lichtenstein, you would have liked this one

2008-02-11T22:48:00.001-03:30

Remember those old waterpaint books, where you just paint with water and the colours all come out? And then they run together and every page looks brown. But, if only for a moment, I thought it was magical. I had a Superman book. I can remember painting in it on the kitchen table. Fun times.

Oreos: the best dessert island discs

2008-02-09T13:01:00.000-03:30

I actually used a picture of Frasier as a model for this one.
Being a radio DJ is something I've secretly wanted to try for a long time, but I think my voice is just too squeaky and annoying to tolerate. However, maybe I could swing a nighttime gig at the old-timey station in town, who knows. Who knows indeed.

Slide, Sled, Slod

2008-02-05T23:23:00.001-03:30

Once I was talking to this girl from NY about sliding, and she said, what, we call it sledding. Not really an interesting conversation, but I thought it was kinda funny.
Also, the Slip 'N' Slide is something I always wanted to try as a kid and never had the chance. I can still remember the song from the TV commercial. As an adult, it seems to me to be the most dangerous and painful looking activity that children participate in. Do they still sell those death mats?

How do they keep coming up with all this Science?

2008-02-03T23:42:00.001-03:30

I also learned that sometimes one twin will ABSORB the other in the womb!
Jay Ingram's Theatre of the Mind

A Very Important Day Indeed

2008-02-01T19:19:00.001-03:30

Rats

2008-01-30T17:42:00.000-03:30

Oh brother, I'm glad I ain't in school no more, that's for sure. What boring times!
I only cheated on two tests, in junior high: in Music and Religion. And look where that got me! In case you don't know me, I think I'm doing alright. Not that I'm a big advocate for cheating. Except when it comes to video games (as I've mentioned before).

It's cold out there! Get your nan to make you a sweater.

2008-01-27T19:11:00.000-03:30

Please please remember to always lift with your legs and not with your back! I am deadly serious. I managed to shag up my back a couple of years ago, and I'm sure shoveling had something to do with it.
This message has been brought to you by a caring friend.
Also, have you read Whiteout yet? It's quite good. Click on the link there to check out the first couple pages.

This guy needs a compass to direct

2008-01-25T13:46:00.000-03:30

That megaphone looks like the cheap cheerleader-type, I know. Cheap megaphone, not cheap cheerleader. I wanted this cheerleader Skipper (Barbie's little sister) real bad for my birthday once. She came with pom poms and a megaphone. And sneakers. I got a different Skipper instead and I wasn't having it. So it was returned to the store and exchanged for the one I wanted. What a jerk. Me, not the doll.

The entrepreneurial spirit

2008-01-23T15:40:00.000-03:30

Lemme start out by saying there are too many t-shirts on the internet that I want to buy and it's not fair. And books and computers and iPods, but I'll stop right there because I'm not rich and you probably aren't either, so I won't even ask you for a dime. At least we have access to computers and can look at all the stuff for free, right? Except for whatever you have to pay for the internet service. Unless you're at work and surf for free when you're supposed to be filling in spreadsheets or making photocopies or whatever. I had a summer job once where I actually did have to fill in spreadsheets. One day, they put me in an empty office with a shredder and I had to shred about five garbage bags full of documents. Now that I think on it, that's a bit shifty. That was a pretty cruddy job, but not the worst!

Game still not Over

2008-01-20T23:02:00.000-03:30

I love my video games, but I get stuck. A lot. Sometimes I cheat on the internet, and it makes me feel all scuzzy inside. But, what can you do? Everybody's doing it, right?
I gotta get back to my game of solitaire.

You could also use tape, but it doesn't look as nice

2008-01-15T12:15:00.001-03:30

This is an idea I had for a screenprint, but it works as a weird comic, too.
I'm hoping to make some on the weekend.

Stay tuned for pics of assembled boxes!

Ch-ch-ch-ch-ch-ch-ch-ch-ch

2008-01-13T13:21:00.000-03:30

It is damn hard to get an egg cooked exactly how you want it, am I right?
Except when you're scrambling, kinda hard to go wrong there. Never poached an egg though. Never really looked that appetizing to me.

Reach for the sky

2008-01-09T22:57:00.000-03:30

The girl in the comic wears a sack-like dress simply because I have no imagination when it comes to costume design, apparantly. Does the job though, covers up the naughty bits and all that.

8 magnificent bits

2008-01-02T17:30:00.000-03:30

There's a hot gallery of 8-bit inspired work here, from a show last year at Gallery 1988:
http://www.iam8bit.net/gallery/gallery.htm
And a wicked awesome Super Mario painting here:
http://drawn.ca/2007/12/31/jose-emroca-flores/

fun fun fun fun fun fun stuff.

Should auld acquaintance be forgot

2007-12-31T13:24:00.000-03:30

A little bit of colour today, to end the new year with a BANG!

Be sure to check out this awesome demo for the new Wacom Cintiq 12WX! It's pretty fancy:
http://drawn.ca/2007/12/27/wacom-cintiq-12wx-video-review-on-gizmodo/

Happy 2008.

A Very Spooky Christmas

2007-12-17T15:41:00.000-03:30

I like the Mickey Mouse version, but my favorite Scrooge movie is Scrooged, with Bill Murray. I like it when the "present" ghost hits him with a toaster. Dickens was a comic genius, indeed.

A Hallowe'en Tribute

2007-10-28T11:00:00.001-02:30

*
*
*
*

Time for a Two-fer

2007-10-12T11:55:00.001-02:30

Yes, it's twoforthepriceofone season once again. This is because I forgot to post on Wednesday. I was actually back on the ball this week. What does "on the ball" mean, you may be asking yourself. Well, the phrase comes from an old European circus family whose specialty was balancing on giant rubber balls while reciting poetry. If you were not "on the ball", you were "on the floor", and therefore not receiving applause.

The Giving of some Thanks

2007-10-08T15:12:00.001-02:30

OH yes, it is Thanksgiving today. And this morning I made some homemade cranberry jelly for the very first time! I kept hearing how easy it was and it is! So easy - here is the recipe so you can make it for your leftover sandwiches!

1 bag cranberries (about 3 cups I suppose), rinsed
1 cup water
1 cup sugar

Boil water and sugar in a saucepan for 5 minutes. Add berries and boil until the skins pop (about 5 minutes or so). Keep boiling until it all breaks down and put into jars and cool. Refrigerate! Consume! Probably good for a few weeks at least...

More mini comics! Take your time!

2007-09-05T20:50:00.001-02:30

Who said that?

2007-08-16T11:38:00.001-02:30

I'm on ventriloquism this week because my dad was raving about this dude, Terry Fator, from America's Got Talent: youtube link . Worth a look, haha!
Just imagine the awesome tricks you could play on people if you really could throw your voice, forget making a doll in your lap chatter on!

Sit on it

2007-08-02T23:23:00.000-02:30

One thing I always wanted as a child was a treehouse. One time, my friend and I spend an afternoon lugging old lumber down the street from her yard to mine, and we made a good pile down by the woods. We didn't have any nails and weren't allowed to use a saw. Then my dad made me get rid of the wood because it was killing the grass.

Don't let them make eye contact

2007-07-23T10:13:00.000-02:30

Yes, I've been yearning for a trip to the zoo, hopefully I'll get to one in the near future. I used to feel really guilty about visiting zoos, but since reading Life of Pi, my guilt has taken a little vacation. My favorite zoo animal? The beaver. Oh, and the giraffe.

Like sands thru the hourglass

2007-07-12T12:59:00.000-02:30

I got addicted to Cinnamon Toast Crunch there a couple of years ago, but that stuff is expensive! These days I'm on the Corn Dunks, a cheaper, yet tastier version of the classic Corn Pops. Give 'em a whirl, whydontcha?

Nifty article

2007-07-08T17:09:00.000-02:30

There's a nice article about webcomics featuring my favorite, Nicholas Gurewitch (The Perry Bible Fellowship), Ryan North (Dinosaur Comics), and Joey Comeau (A Softer World), and Dorothy Gambrell (Cat and Girl)

HERE.

Kh-kh-kh-kh-kh-kh-khee

2007-07-08T15:26:00.000-02:30

Oh yes, Transformers was an enjoyable experience, albeit a bit hard on the ass. There should definately be more robot-based entertainment, both on and off screen. Once, I said that I'd like a robot to wash my dishes, and I was quickly reminded that we already have a thing called the dishwasher. I'll have to ponder this a little longer, I suppose.

Who doesn't like a good quote?

2007-07-01T23:21:00.000-02:30

The use of quotes is pretty lame; I've only ever used them in essays. Have you ever heard somebody use one in actual conversation that wasn't meant for comic effect? But I can really appreciate the Yoda quotes, let me tell you. That dude was wise.

G-g-g-g-g-g-g-g-g-g-g-ghooooooooost!

2007-06-23T15:56:00.000-02:30

So far my theories are that some of us are walking around as ghosts, and some of us are in dreams. Or perhaps a comination of the two. Although ghosts probably don't dream if they don't have to sleep. THIS is a question for Dumbledore. Or somebody.

A test of art

2007-06-20T22:59:00.000-02:30

Oh yes, I sent in a few of those art tests and never got an answer back. I thought it was a scam, until, one day my friend got a response! I think they gave her an 86% or something like that.

I've got a hard time writing a haiku

2007-06-17T22:07:00.001-02:30

I can't comprehend how someone could write an entire novel. Or a musical composition! What are these people, robots? Kudos to you, robot creators. And well done at keeping your true identities a secret.

Tiny Comix Extravaganza!

2007-06-14T23:34:00.000-02:30

Cans and boobs, hehe.

I never realized that the word extravaganza has an x and a z!

Here are a bunch of comics that I've drawn for The Scope over the past couple of months.

What is suet exactly, anyway?

2007-06-11T18:46:00.001-02:30

Do birds get picky? I guess they've got a lot to choose from in the summertime, with all the berries and insects, and whatnot.
A treat for today: some colour! I'm in such a good mood 'cause I bought a new birdfeeder. Wish me luck!

Whatever you say, Science

2007-06-04T10:48:00.001-02:30

Article here.

Fascinating Kirk Cameron creation series at YouTube here. The banana video is especially educational.

What I meant is, they always tell you to wash your hands after handling library books. In elementary school, remember?

2007-05-30T18:18:00.000-02:30

Missed a couple days because I actually was sick! But I got to battle many a troll and joined the order of Knights of my choosing. I was playing a lot of Puzzle Quest on my DS. So much fun in such a tiny package.

Sailing over a cardboard sea

2007-05-23T06:51:00.000-02:30

I used to know how to make a paper crane and a paper frog -- that jumps! And I tried paper cups one time, but they really aren't very practical.

Freebies

2007-05-21T17:28:00.001-02:30

I don't know if they make you save up for free stuff anymore; they just give away DVDs and stuff right in the cereal box. No wait time. This is why children have short attention spans these days, not because of video games and the internet.

Grhaauuuuuuuuw

2007-05-16T13:33:00.000-02:30

I don't really know how to spell the sound a wookiee makes.
There's a very interesting wookiee article at Wikipedia: http://en.wikipedia.org/wiki/Wookiee

Always wear your helmet

2007-05-15T11:54:00.000-02:30

Nope, still can't draw a bike. And I almost fell off my new bike last week trying to go over the bloody snow left on the trail, haha.

Yeah! Bring back the dinosaurs!!

2007-05-10T23:06:00.000-02:30

I think I heard a little while ago that "scientists" have found a way to use dinosaur DNA, similar to what they did in Jurassic Park. Am I crazy? Did anybody else hear that? Anyhow, I think that's bad news. Don't mess around with the nature like that. If they're all dead, there must be a good reason. Also, check out an awesome daily dinosaur comic here: Qwantz.com

Fishy

2007-05-07T16:54:00.000-02:30

I always wanted some pet fish, but I don't really think I could handle the responsibility of tank cleaning, not to mention the short life spans. Once when I was house-sitting, the pet newt died and dried up like a piece of jerky. I gave it a buriel at sea.

Supergirl Remodled

2007-05-06T23:53:00.000-02:30

Here's what I posted at The Engine, where they've invited people to remake Supergirl (among others). I thought this is the version that would be distributed at dentist offices and elementary schools.

Tap tap tap

2007-05-02T12:20:00.000-02:30

I'd watch Size Small when I was little, and I'd run to the kitchen to get spoons when Friend Record came on. But by the time I got back to the TV he would be finishing up. I don't know why I didn't learn to just keep a set in the living room. I could have been a spoonin' virtuoso.

Nightmare

2007-04-30T11:25:00.000-02:30

You never know, do you? Everything you think and do is probably completely insignificant. Even if your life isn't a dream.

Wash 'n' Go

2007-04-29T13:51:00.000-02:30

I remember my neighbour's laundry being frozen on the clothesline during the winter. I don't think my mom ever bothered to hang out stuff in the winter. I used to hate hanging clothes, but now I love it. Except for the fact that the clothes are usually a bit stiff and wrinkly when they're dry. But it makes the sheets smell pretty nice.

Hot fun in the summertime

2007-04-25T11:07:00.000-02:30

Ice cream and the beach is top of the pops.
We finally had a warm day here yesterday, but it was windy enough to blow the head off ya. Not quite BBQ season yet. I also heard yesterday that grilling meat can kill you, but everybody already knew that, right?

Forty-somethin' wpm

2007-04-23T18:24:00.000-02:30

I think my cousin had a Commodore 64, and the only game I can remember is Ally Oop. It was definitely a caveman game, anyway. Had to use the joystick to hop over stone wheels and junk. Also, I used to think typing was really fun when I was a kid. Home computers not as common back then. Hear what I'm sayin'?

EDIT: The game was BC's Quest for Tires (thanks sak)

Couple more

2007-04-20T10:23:00.000-02:30

Street Food: Food of the Street

2007-04-18T09:05:00.000-02:30

When I went to New York I was kind of excited to have a street pretzel. When I finally got one, it was dry and bland - quite a disappointment. They have great roasted nuts down there though, they smell like cotton candy! A must for any tourist.

Pretend it's Monday

2007-04-15T22:47:00.000-02:30

This one was inspired by the trailer for that movie Disturbia, which looks like a huge knock-off of Hitchcock's Rear Window. That movie, by the way, is awesome, if you can get your hands on a copy. Hard times finding old movies around these days, hey?

Jerktaur

2007-04-14T13:44:00.000-02:30

I'm telling you, Pegasus is the way to go.

That's what friends are for

2007-04-11T18:57:00.000-02:30

This one was also written for The Scope - it's been a busy week!
Don't get me wrong - I'm not taking a shot at Batman, but he's just a regular dude, right? He must get very tired. So he probably calls in a favor now and then.

Pick a horse

2007-04-09T17:35:00.000-02:30

Pegasus is the obvious choice -- just fly away from the poison! And sell all the damn eggs.

Another Super Holiday Two-for-One Special

2007-04-06T11:26:00.000-02:30

Hope you're having a lovely long weekend. And don't eat too much junk on Sunday, you know you'll regret it.

I like honey in my tea now

2007-04-04T11:24:00.000-02:30

Today's lesson is be nice to everybody, because you don't know how sensitive people can be. And it feels bad to make someone cry. Unless you're an a-hole.

A refresher

2007-04-02T11:42:00.000-02:30

I often think about what I would cook on TV, given the chance. It would have to be something I'm very comfortable with, obviously. It would probably be very boring, like "pancakes", or "bowl of cereal". I like breakfast foods, by the way.

A chain of events

2007-03-30T12:18:00.000-02:30

It's like the domino effect. I had a box of dominoes, but there were only about twenty, so it wasn't really much fun.

Twinless

2007-03-28T09:02:00.000-02:30

I always wanted a twin or an older sister. *S* out of luck from the start! But a robot, now that's still possible.

It's getting hot out here

2007-03-26T11:48:00.000-02:30

I used a brushpen to ink this one, which I liked, but was probably a poor choice for the text. This could have been a good way to end this comic, if I wanted to, since the b'ys are totally screwed. I always keep a deck of cards in the car, you never know when disaster may strike.